ID: 998669485_998669489

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998669485 998669489
Species Human (GRCh38) Human (GRCh38)
Location 5:144337781-144337803 5:144337796-144337818
Sequence CCTGATCTATCTATACATAGTGA CATAGTGAAGGGAGAAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90} {0: 1, 1: 0, 2: 2, 3: 39, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!