ID: 998817489_998817497

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 998817489 998817497
Species Human (GRCh38) Human (GRCh38)
Location 5:146028847-146028869 5:146028900-146028922
Sequence CCACAGGTAGGATGGGGAGACTT AACACGAACGCGCTCCTAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!