ID: 998852425_998852430 |
View in Genome Browser |
Spacer: 12 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 998852425 | 998852430 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:146363967-146363989 | 5:146364002-146364024 |
| Sequence | CCCAAATAATCTAGAGAGTTATA | CAGAAGAAGGAGATGAAGGGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 5, 3: 93, 4: 1119} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||