ID: 998870649_998870652

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998870649 998870652
Species Human (GRCh38) Human (GRCh38)
Location 5:146548367-146548389 5:146548382-146548404
Sequence CCTGCTCGTGGTGCAGTAGAATC GTAGAATCTGGAAAATGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!