ID: 998879621_998879634

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 998879621 998879634
Species Human (GRCh38) Human (GRCh38)
Location 5:146632968-146632990 5:146633015-146633037
Sequence CCCCAGGTTGGTGTCCATTACAC CCGATACTCATGCGTGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!