ID: 998880291_998880299

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 998880291 998880299
Species Human (GRCh38) Human (GRCh38)
Location 5:146638386-146638408 5:146638437-146638459
Sequence CCATGTTGGCTGGCTTAATGTCC AGGAACCAGGAGAAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 110} {0: 1, 1: 0, 2: 13, 3: 101, 4: 1052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!