ID: 998883636_998883638

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 998883636 998883638
Species Human (GRCh38) Human (GRCh38)
Location 5:146671368-146671390 5:146671396-146671418
Sequence CCGCTAAATGGTGGGTTTGATGA TTGCATAAACAAATAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 170} {0: 1, 1: 0, 2: 1, 3: 13, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!