ID: 998887169_998887174

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 998887169 998887174
Species Human (GRCh38) Human (GRCh38)
Location 5:146706531-146706553 5:146706559-146706581
Sequence CCTACTTGGTCTGCTGAAGGGCG CAGCTCGGACAGCTTAGCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112} {0: 1, 1: 7, 2: 13, 3: 16, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!