ID: 998892247_998892255

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 998892247 998892255
Species Human (GRCh38) Human (GRCh38)
Location 5:146758624-146758646 5:146758665-146758687
Sequence CCCCATCCTGAATCCTTAGCATC TAGTAGGAGCTTAATACCTACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!