ID: 998896883_998896888

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 998896883 998896888
Species Human (GRCh38) Human (GRCh38)
Location 5:146809529-146809551 5:146809575-146809597
Sequence CCTTATTTAGAGGGAGTGGTCAG ACGTATCAGCTAAAACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 103} {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!