ID: 998937112_998937116 |
View in Genome Browser |
Spacer: 29 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 998937112 | 998937116 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:147241040-147241062 | 5:147241092-147241114 |
| Sequence | CCATGAACCTTCTAAAAATAAGG | AATTAGGAGTTTGTCATGATTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 10, 4: 151} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||