ID: 998938654_998938656

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 998938654 998938656
Species Human (GRCh38) Human (GRCh38)
Location 5:147257204-147257226 5:147257225-147257247
Sequence CCACAGAACATTGGACCAACTAC ACAGCATAAAAGCTCTACGTCGG
Strand - +
Off-target summary {0: 9, 1: 29, 2: 51, 3: 48, 4: 84} {0: 2, 1: 8, 2: 20, 3: 38, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!