|
Left Crispr |
Right Crispr |
| Crispr ID |
998938654 |
998938663 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:147257204-147257226
|
5:147257236-147257258
|
| Sequence |
CCACAGAACATTGGACCAACTAC |
GCTCTACGTCGGGGGCGGGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 29, 2: 51, 3: 48, 4: 84} |
{0: 1, 1: 0, 2: 2, 3: 12, 4: 112} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|