ID: 998938654_998938665 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 998938654 | 998938665 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:147257204-147257226 | 5:147257238-147257260 |
Sequence | CCACAGAACATTGGACCAACTAC | TCTACGTCGGGGGCGGGGCGGGG |
Strand | - | + |
Off-target summary | {0: 9, 1: 29, 2: 51, 3: 48, 4: 84} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |