ID: 998938655_998938667 |
View in Genome Browser |
Spacer: -2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 998938655 | 998938667 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:147257219-147257241 | 5:147257240-147257262 |
Sequence | CCAACTACAGCATAAAAGCTCTA | TACGTCGGGGGCGGGGCGGGGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 56, 4: 486} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |