ID: 998940468_998940472

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 998940468 998940472
Species Human (GRCh38) Human (GRCh38)
Location 5:147276679-147276701 5:147276709-147276731
Sequence CCACCCTCATTAAGCTTATGCTA TGAAATAAACTCAGAAGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120} {0: 1, 1: 1, 2: 5, 3: 132, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!