ID: 998956623_998956626

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 998956623 998956626
Species Human (GRCh38) Human (GRCh38)
Location 5:147445371-147445393 5:147445413-147445435
Sequence CCTTATTTAGAAGTTAATATTCT GCTTATGTACAAGAACAAATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!