ID: 999028901_999028905

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 999028901 999028905
Species Human (GRCh38) Human (GRCh38)
Location 5:148268016-148268038 5:148268058-148268080
Sequence CCACAACCAAGGTCTGGAGCAGG ATCCCAACTTGGAAGAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 202} {0: 1, 1: 0, 2: 2, 3: 30, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!