ID: 999036035_999036038

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 999036035 999036038
Species Human (GRCh38) Human (GRCh38)
Location 5:148350826-148350848 5:148350867-148350889
Sequence CCATACTGCTTCTGCATAGTAGT GAAATAAAAAAAGAAAGGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 84, 3: 1249, 4: 11100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!