ID: 999036904_999036906

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 999036904 999036906
Species Human (GRCh38) Human (GRCh38)
Location 5:148361669-148361691 5:148361682-148361704
Sequence CCTAGCTTGTAGAGATGATTTAA GATGATTTAAAATATACAGGAGG
Strand - +
Off-target summary No data {0: 21, 1: 220, 2: 545, 3: 900, 4: 1130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!