ID: 999041869_999041874

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 999041869 999041874
Species Human (GRCh38) Human (GRCh38)
Location 5:148422801-148422823 5:148422842-148422864
Sequence CCTGCATAAAAACCTAGTGGTTT CAATTCTAAGCTTTTTAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 203} {0: 1, 1: 1, 2: 5, 3: 28, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!