ID: 999045828_999045841

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 999045828 999045841
Species Human (GRCh38) Human (GRCh38)
Location 5:148468457-148468479 5:148468502-148468524
Sequence CCTTAGAAGGAAGAACTGAATCT GGGTGTCTTTCTAGGAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!