ID: 999054293_999054301

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 999054293 999054301
Species Human (GRCh38) Human (GRCh38)
Location 5:148557216-148557238 5:148557255-148557277
Sequence CCAGGTAAAAGAAGATGGTAGTT CTGGGGAGATGGAGAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 278} {0: 1, 1: 2, 2: 12, 3: 123, 4: 1131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!