|
Left Crispr |
Right Crispr |
Crispr ID |
999061329 |
999061334 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:148638888-148638910
|
5:148638921-148638943
|
Sequence |
CCACAAAAAATTAGATGGGCGTG |
CCTGTAGTTCCAGCTACCTGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 9, 2: 69, 3: 246, 4: 526} |
{0: 6, 1: 215, 2: 1902, 3: 4799, 4: 7680} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|