|
Left Crispr |
Right Crispr |
| Crispr ID |
999061329 |
999061336 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:148638888-148638910
|
5:148638923-148638945
|
| Sequence |
CCACAAAAAATTAGATGGGCGTG |
TGTAGTTCCAGCTACCTGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 69, 3: 246, 4: 526} |
{0: 112, 1: 3905, 2: 56534, 3: 173211, 4: 229178} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|