|
Left Crispr |
Right Crispr |
| Crispr ID |
999061329 |
999061339 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:148638888-148638910
|
5:148638932-148638954
|
| Sequence |
CCACAAAAAATTAGATGGGCGTG |
AGCTACCTGGGGGGCTGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 69, 3: 246, 4: 526} |
{0: 45, 1: 1188, 2: 15553, 3: 30730, 4: 46637} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|