ID: 999088407_999088413

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 999088407 999088413
Species Human (GRCh38) Human (GRCh38)
Location 5:148913319-148913341 5:148913366-148913388
Sequence CCTCATGCTGCTTCATCCTGGGA ATGCATTTCAAGATTCCCGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!