ID: 999096562_999096568

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 999096562 999096568
Species Human (GRCh38) Human (GRCh38)
Location 5:148983489-148983511 5:148983526-148983548
Sequence CCAGGTGGAGGTCCCAAGAAACC TTTTTACAGTTCTGCATATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 100} {0: 1, 1: 0, 2: 1, 3: 33, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!