ID: 999116423_999116427

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999116423 999116427
Species Human (GRCh38) Human (GRCh38)
Location 5:149168148-149168170 5:149168170-149168192
Sequence CCCCAATAGAGAACTGGTGAACT TAGAGAAGAGATGCGGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 216} {0: 1, 1: 0, 2: 7, 3: 16, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!