ID: 999122017_999122022

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 999122017 999122022
Species Human (GRCh38) Human (GRCh38)
Location 5:149217061-149217083 5:149217078-149217100
Sequence CCCTCTGTAAGGCCTTCCGACCT CGACCTGCTCATGACTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 79} {0: 1, 1: 0, 2: 1, 3: 7, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!