ID: 999130468_999130476

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 999130468 999130476
Species Human (GRCh38) Human (GRCh38)
Location 5:149279100-149279122 5:149279146-149279168
Sequence CCACATGAGAAGTTATTGAAGGA CTAAAGTTGAAGTGGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 191} {0: 1, 1: 1, 2: 1, 3: 13, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!