ID: 999134671_999134672

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 999134671 999134672
Species Human (GRCh38) Human (GRCh38)
Location 5:149310621-149310643 5:149310641-149310663
Sequence CCAAGAGCTTTACATACGTGACC ACCTCATTTCTGCTTGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!