ID: 999138850_999138854

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 999138850 999138854
Species Human (GRCh38) Human (GRCh38)
Location 5:149343594-149343616 5:149343644-149343666
Sequence CCTTAACAAGGAAGCAAAAGAAA TGGACACAGTTACTTTACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 88, 4: 1043} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!