ID: 999145619_999145623

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 999145619 999145623
Species Human (GRCh38) Human (GRCh38)
Location 5:149391355-149391377 5:149391369-149391391
Sequence CCAGGCTTAGAGGCATGGAGAAC ATGGAGAACCTCAGCCACGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 132} {0: 1, 1: 0, 2: 1, 3: 33, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!