ID: 999148550_999148554

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 999148550 999148554
Species Human (GRCh38) Human (GRCh38)
Location 5:149411896-149411918 5:149411909-149411931
Sequence CCATTATCCCTCTGGGCACACAG GGGCACACAGAGGCTCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 231} {0: 1, 1: 1, 2: 44, 3: 526, 4: 2506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!