ID: 999148550_999148557

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 999148550 999148557
Species Human (GRCh38) Human (GRCh38)
Location 5:149411896-149411918 5:149411947-149411969
Sequence CCATTATCCCTCTGGGCACACAG AAAGTCACACAGCCTGTACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 231} {0: 1, 1: 0, 2: 31, 3: 258, 4: 1298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!