ID: 999198967_999198974

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 999198967 999198974
Species Human (GRCh38) Human (GRCh38)
Location 5:149802640-149802662 5:149802680-149802702
Sequence CCTCATGACACTTCTGTGAGGCA ACAGATGGGGCAGCTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 362} {0: 1, 1: 0, 2: 13, 3: 118, 4: 886}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!