ID: 999204901_999204909

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999204901 999204909
Species Human (GRCh38) Human (GRCh38)
Location 5:149840826-149840848 5:149840848-149840870
Sequence CCTGCTGAGTCTCTCCCATGTGA ATGTGGCACTTCAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 345} {0: 1, 1: 0, 2: 1, 3: 30, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!