ID: 999223565_999223582

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 999223565 999223582
Species Human (GRCh38) Human (GRCh38)
Location 5:150001107-150001129 5:150001158-150001180
Sequence CCATCCCCCTCGTCCAGCCGCCG CGCAGCTTGCACGCTCCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 282} {0: 1, 1: 0, 2: 1, 3: 6, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!