|
Left Crispr |
Right Crispr |
| Crispr ID |
999229794 |
999229795 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:150054967-150054989
|
5:150054994-150055016
|
| Sequence |
CCGGGCTACAGAGCAAGATGCTG |
AAAAAAAAAAAAAAAAAAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|