ID: 999242835_999242844

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 999242835 999242844
Species Human (GRCh38) Human (GRCh38)
Location 5:150137517-150137539 5:150137548-150137570
Sequence CCAGAGAACTCCCGCAGCTCCAC CAGGAAATGGAGGAGGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149} {0: 1, 1: 0, 2: 6, 3: 66, 4: 631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!