ID: 999243560_999243570

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 999243560 999243570
Species Human (GRCh38) Human (GRCh38)
Location 5:150140982-150141004 5:150141000-150141022
Sequence CCAGGGAGGGGGCCCTGCATTGC ATTGCTGCGGGGGTTGATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!