ID: 999261195_999261199

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 999261195 999261199
Species Human (GRCh38) Human (GRCh38)
Location 5:150239917-150239939 5:150239949-150239971
Sequence CCTGGCGGGGCCAGTCCTCGTCC GAGTCCTCATGCACACTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129} {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!