ID: 999271363_999271373

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 999271363 999271373
Species Human (GRCh38) Human (GRCh38)
Location 5:150298107-150298129 5:150298146-150298168
Sequence CCTCATCCATGCAGGTCACCATG GGGCCACATTGCCCATGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204} {0: 1, 1: 0, 2: 2, 3: 31, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!