ID: 999271366_999271373

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 999271366 999271373
Species Human (GRCh38) Human (GRCh38)
Location 5:150298125-150298147 5:150298146-150298168
Sequence CCATGGCCGCGTACTTCCGCCGG GGGCCACATTGCCCATGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 18} {0: 1, 1: 0, 2: 2, 3: 31, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!