ID: 999273029_999273030 |
View in Genome Browser |
Spacer: 2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 999273029 | 999273030 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:150309056-150309078 | 5:150309081-150309103 |
Sequence | CCTATAAGGTAGGTAAAATTATT | CATTATCTGCATCTTGCCCATGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 2, 2: 48, 3: 302, 4: 1337} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |