ID: 999273029_999273030

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 999273029 999273030
Species Human (GRCh38) Human (GRCh38)
Location 5:150309056-150309078 5:150309081-150309103
Sequence CCTATAAGGTAGGTAAAATTATT CATTATCTGCATCTTGCCCATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 48, 3: 302, 4: 1337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!