ID: 999275238_999275252

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 999275238 999275252
Species Human (GRCh38) Human (GRCh38)
Location 5:150325654-150325676 5:150325706-150325728
Sequence CCCTCCACCCTCTGCACACCAAG TCTCCCTTGCCGTGGACTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 399} {0: 1, 1: 0, 2: 2, 3: 10, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!