ID: 999287847_999287854

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 999287847 999287854
Species Human (GRCh38) Human (GRCh38)
Location 5:150404872-150404894 5:150404899-150404921
Sequence CCAACACCCGGGTCCAGCTGCAG GTTCCCTCTTAAAGACCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 219} {0: 1, 1: 0, 2: 2, 3: 3, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!