ID: 999289010_999289018

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 999289010 999289018
Species Human (GRCh38) Human (GRCh38)
Location 5:150411479-150411501 5:150411528-150411550
Sequence CCTGGCAACAGCTGACATCACAC AATTACTTTTTGGAGACTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 154} {0: 1, 1: 0, 2: 5, 3: 18, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!