ID: 999302518_999302526

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 999302518 999302526
Species Human (GRCh38) Human (GRCh38)
Location 5:150500040-150500062 5:150500089-150500111
Sequence CCCTTGTCCAACTGTCTGTCCCG GAAATCTTAAGTATTCCCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!